Granulocyte-macrophage colony-stimulating factor (GM-CSF) is an autocrine and a paracrine cytokine.It stimulates growth, differentiation and function of normal and leukemic myeloid progenitors.GM-CSF augments both innate and adaptive immunity by facilitating growth and function of neutrophils, macrophages, monocytes and dendritic cells.In particular, GM-CSF enhances the antigen-presenting ability of monocytes, promotes antibody-dependent cellular cytotoxicity ofneutrophils and mononuclear cells, increases leukocyte chemotaxis and augments expression of adhesion molecules on granulocytes and monocytes.Additionally, GM-CSF either alone or in combination with other therapeutic agents may enhance the immunogenicity of tumor cells by facilitating tumor antigen presentation.GM-CSF has been implicated in leukemiogenesis, since altered regulation of GM-CSF expression in myeloproliferative disorders is complex, there is some evidence that GM-CSF is involved in the induction of acute myeloid leukemia (AML).Partial and complete deletion of the GM-CSF gene, including deletion of 5q31 occurs in chromosomal abnormalities, which are associated with secondary AML and myelodysplastic syndromes (MDS), suggesting a complex role of GM-CSF dysregulation in leukemiogenesis.Since there is evidence that GM-CSF might be involved in the autocrine or paracrine growth of leukemia.In this study we Examined the GM-CSF m-RNA gene expression in cases of newly diagnosed or relapced acute Myeloid leukemia/myelodysplastic syndrome & their correlation to disease activity & prognosis.GM-CSF mRNA gene expression by real time-PCR (quantitative):Total mRNA is isolated from thawed blood MNCs cells.RNA is used as a template for synthesis of corresponding cDNA by reverse transcription.c DNA amplified by reverse transcriptase-PCR to detect the target gene (GM-CSF) using Forward (59CTGCTGAGATGAATGAAACAG), Reverse (59TCCAAGATGACCATCCTGAG) primers and Probe (59-ACTCCCACCATGGCTGTGG) applied by TaqMan Biosystems GM-CSF acess NO M11220.Then we correlate all results with all clinical data & behavior of disease in all included patients.